miRNA annotation¶
miRNA annotation is running inside bcbio small RNAseq pipeline together with other tools to do a complete small RNA analysis.
For some comparison with other tools go here.
You can run samples after processing the reads as shown below. Currently there are two version: JAVA
Naming
See always up to date information here in mirtop open project.
It is a working process, but since 10-21-2015 isomiR naming has changed to:
Nucleotide substitution:
NUMBER|NUCLEOTIDE_ISOMIR|NUCLEOTIDE_REFERENCE
means at the position giving by the number the nucleotide in the sequence has substituted the nucleotide in the reference. This, as well, is a post-transcriptional modification.Additions at 3’ end:
0/NA
means no modification.UPPER CASE LETTER
means addition at the end. Note these nucleotides don’t match the precursor. So they are post-transcriptional modification.Changes at 5’ end:
0/NA
means no modification.UPPER CASE LETTER
means nucleotide insertions (sequence starts before miRBase mature position).LOWWER CASE LETTER
means nucleotide deletions (sequence starts after miRBase mature position).Changes at 3’ end:
0/NA
means no modification.UPPER CASE LETTER
means nucleotide insertions (sequence ends after miRBase mature position).LOWWER CASE LETTER
means nucleotide deletions (sequence ends before miRBase mature position).
Processing of reads¶
REMOVE ADAPTER
I am currently using cutadapt
.
cutadapt --adapter=$ADAPTER --minimum-length=8 --untrimmed-output=sample1_notfound.fastq -o sample1_clean.fastq -m 17 --overlap=8 sample1.fastq
COLLAPSE READS
To reduce computational time, I recommend to collapse sequences, also it would help to apply filters based on abundances. Like removing sequences that appear only once.
seqcluster collapse -f sample1_clean.fastq -o collapse
Here I am only using sequences that had the adapter, meaning that for sure are small fragments. The output will be named as sample1_clean_trimmed.fastq
Prepare databases¶
For human or mouse, follows this instruction to download easily miRBase files. In general you only need hairpin.fa and miRNA.str from miRBase site. mirGeneDB is also supported, download the needed files here.
Highly recommended to filter hairpin.fa to contain only the desired species.
miRNA/isomiR annotation with JAVA¶
MIRALIGNER
Download the tool from miraligner repository.
Download the mirbase files (hairpin and miRNA) from the ftp and save it to DB folder.
You can map the miRNAs with.
java -jar miraligner.jar -sub 1 -trim 3 -add 3 -s hsa -i sample1_clean_trimmed.fastq -db DB -o output_prefix
Cite
SeqBuster is a bioinformatic tool for the processing and analysis of small RNAs datasets, reveals ubiquitous miRNA modifications in human embryonic cells. Pantano L, Estivill X, Martí E. Nucleic Acids Res. 2010 Mar;38(5):e34. Epub 2009 Dec 11.
NOTE: Check comparison of multiple tools for miRNA annotation.
Convert to GFF3-srna¶
Use mirtop to convert to GFF3-srna format. This is the desired format to share the isomiR information and can be used to join multiple projects together easily.
See this <http://mirtop.readthedocs.io/en/dev/quick_start.html#from-seqbuster-miraligner-files-to-gff3> to know how to convert all the output into a single file and share easily with collaborators:
mirtop gff --format seqbuster --sps hsa --hairpin database/hairpin.fa --gtf database/hsa.gff3 -o test_out out_folder/*/*.mirna
Post-analysis with R¶
Use the outputs to do differential expression, clustering and descriptive analysis with this package: isomiRs
To load the data you can use IsomirDataSeqFromFiles function and get the count data with isoCounts to move to DESeq2 or similar packages.
Manual of miraligner(JAVA)¶
options
Add -freq
if you have your fasta/fastq file with this format and you want a third column with the frequency (normally value after x character):
>seq_1_x4
CACCGCTGTCGGGGAACCGCGCCAATTT
Add -pre
if you want also sequences that map to the precursor but outside the mature miRNA
Parameter -sub: mismatches allowed (0/1)
Parameter -trim: nucleotides allowed for trimming (max 3)
Parameter -add: nucleotides allowed for addition (max 3)
Parameter -s: species (3 letter, human=>hsa)
Parameter -i: fasta file
Parameter -db: folder where miRBase files are(one copy at miraligner-1.0/DB folder)
Parameter -o: prefix for the output files
Parameter -freq: add frequency of the sequence to the output (just where input is fasta file with name matching this patter: >seq_3_x67)
Parameter -pre: add sequences mapping to precursors as well
input
A fasta/fastq file reads:
>seq
CACCGCTGTCGGGGAACCGCGCCAATTT
or tabular file with counts information:
CACCGCTGTCGGGGAACCGCGCCAATTT 45
output
Track file *.mirna.opt: information about the process
Non mapped sequences will be on *.nomap
Header of the *.mirna.out file:
seq: sequence
freq/name: depending on the input this column contains counts (tabular input file) or name (fasta file)
mir: miRNA name
start: start of the sequence at the precursor
end: end of the sequence at the precursor
mism: nucleotide substitution position | nucleotide at sequence | nucleotide at precursor
addition: nucleotides at 3 end added:
precursor => cctgtggttagctggttgcatatcc annotated miRNA => TGTGGTTAGCTGGTTGCATAT sequence add: TT => TGTGGTTAGCTGGTTGCATATTT
tr5: nucleotides at 5 end different from the annonated sequence in miRBase:
precursor => cctgtggttagctggttgcatatcc annotated miRNA => TGTGGTTAGCTGGTTGCATAT sequence tr5: CC => CCTGTGGTTAGCTGGTTGCATAT sequence tr5: tg => TGGTTAGCTGGTTGCATAT
tr3: nucleotides at 3 end different from the annotated sequence in miRBase:
precursor => cctgtggttagctggttgcatatcc annotated miRNA => TGTGGTTAGCTGGTTGCATAT sequence tr3: cc => TGTGGTTAGCTGGTTGCATATCC sequence tr3: AT => TGTGGTTAGCTGGTTGCAT
s5: offset nucleotides at the begining of the annotated miRNAs:
precursor => agcctgtggttagctggttgcatatcc annotated miRNA => TGTGGTTAGCTGGTTGCATAT s5 => AGCCTGTG
s3:offset nucleotides at the ending of the annotated miRNAs:
precursor => cctgtggttagctggttgcatatccgc annotated miRNA => TGTGGTTAGCTGGTTGCATAT s3 => ATATCCGC
type: mapped on precursor or miRNA sequences
ambiguity: number of different detected precursors
Example:
seq miRNA start end mism tr5 tr3 add s5 s3 DB amb
TGGCTCAGTTCAGCAGGACC hsa-mir-24-2 50 67 0 qCC 0 0 0 0 precursor 1
ACTGCCCTAAGTGCTCCTTCTG hsa-miR-18a* 47 68 0 0 0 tG ATCTACTG CTGGCA miRNA 1